Aktuální číslo:

2017/12

Téma měsíce:

Kontakty

Molekuly na povel II.

I jediná molekula DNA se hledá mnohem lépe než jehla v kupce sena
 |  5. 5. 1998
 |  Vesmír 77, 312, 1998/6
 |  Seriál: Molekuly na povel, 2. díl (PředchozíNásledující)

Jan Amos Komenský a možná ještě i Johann Wolfgang Goethe měli to obrovské štěstí, že žili v době, kdy mohli porozumět fungování většiny strojů a přístrojů, jakož i principu používaných pracovních postupů. My naopak žijeme obklopeni spoustou převážně černých a šedivých beden, v jejichž nitru se dějí nepochopitelné věci, a používáme výrobky získané naprosto nejasnými cestami. Když ležel Ignác z Loyoly smrtelně raněn na lůžku, věděl, že buď zemře, nebo přežije, a jednoduché léčení pouštěním žilou či přikládáním náčinků na to nemuselo mít žádný vliv. Lidé tehdy světu kolem sebe rozuměli, a čemu nerozuměli, to bylo v rukou božích. Dnes v nemocnici z několika kapek nejrůznějších tělních tekutin o vás zjistí úžasné informace. Vám to sice nic neřekne, ale spoléháte se, že z toho nějaký odborník vyčte něco důležitého.

Molekulární biologie je také jeden z oborů, který se vymkl z kontroly porozumění daňového poplatníka. Zkusme se ale přece jenom podívat do tyglíků a baněk moderní laboratoře. Třeba se ukáže, že to zas taková hrůza není.

Vyrobte si sondu

Představte si, že máte izolovanou čistou DNA z buněk klokana. Máte jí hodně, máte dost peněz i času, vhodnou náladu, všechny potřebné přístroje i chemikálie, a chcete zjistit, jestli se v této DNA nachází gen pro skákání buší stejný jako v DNA tarbíka (pevně doufám, že žádný takový gen neexistuje). Pořadí nukleotidů genu Sbuš (skákání buší) u tarbíka znáte a celý ten gen máte v ledničce v dostatečném množství (přesněji: ve zkumavce máte několik zcela čirých mikrolitrů destilované vody, v níž snad plavou miliardy molekul). Pokud je gen Sbuš u klokana stejný jako u tarbíka, musí být jednořetězce těchto genů k sobě komplementární, musí spolu vytvářet hybridní tarbíkoklokaní dvouřetězec! Přítomnost genu Sbuš u klokana potvrdíme tedy tak, že prokážeme schopnost nějakého úseku klokaní DNA párovat se s DNA genu Sbuš od tarbíka. Jak prosté.

Prvním krokem je příprava sondy, tedy kousku DNA, který nám komplementární molekulu vyhledá a označkuje. Sonda bude v našem hypotetickém případě vytvořena z DNA genu Sbuš u tarbíka. Tuto DNA ale samozřejmě vůbec nevidíme, tak jako v molekulární biologii nevidíme nikdy nic, s čím pracujeme. Proto ji musíme nějak označit, musíme ji, řečeno publicistickou hantýrkou, zviditelnit. To se nejčastěji dělá dvěma způsoby:

  • Do molekuly DNA vložíme radioaktivní nukleotidy.
  • Do molekuly DNA vložíme nukleotidy spojené s nějakou velkou, nápadnou molekulou, dobře rozeznávanou specifickými protilátkami. V dnešní době se k tomu velmi často používají nukleotidy s navázaným digoxygeninem, což je látka získaná z náprstníku (Digitalis).

Takto označenou DNA už umíme rozeznat. Radioaktivní sonda pochopitelně vyzařuje radioaktivní záření, které zachytíme na citlivý film (stejný jako na rentgenované kosti). Sonda značená digoxygeninem se zviditelňuje složitěji (ale zase nás neozařuje) – nejdříve ji necháme reagovat s protilátkou, a poté přidáme nějakou bezbarvou látku, kterou enzym napojený na protilátku změní na barvičku (obrázek). Jak říkám, je to trochu složitější, ale není třeba si s tím lámat hlavu. Prostě umíme zařídit, abychom i takovouto sondu „uviděli“.

Hledáme molekulu!

Vlastní hledání v genomu obvykle neprobíhá v roztoku, ale na nějakém nosiči. Jednořetězcovou DNA, v níž budeme hledat, přeneseme a uchytíme na nosič, např. na nylonovou membránu. Je velice důležité, aby byla jednořetězcová – chceme přece, aby vytvářela hybridní dvouřetězce se sondou, kterou jsme dodali (mimochodem, podle toho se celému procesu říká hybridizace). Kdyby prohledávaná DNA byla od začátku dvouřetězcová, s žádnou jinou molekulou by se nemohla párovat, protože všechny ručičky jejích nukleotidů by se už někde držely! K jednořetězcové prohledáváné DNA uchycené na nosiči přidáme sondu, která musí být také jednořetězcová. Proto sondu před přidáním k membráně 10 minut vaříme úplně stejně jako např. vajíčka před přidáním do bramborového salátu. Membránu se sondou vystavíme – a teď pozor – relativně vysoké teplotě. Používáme takovou teplotu, aby se spojení vytvořilo jenom tehdy, pokud jsou řetězce zcela komplementární. Kdybychom nechali vzorky při nízké teplotě, mohla by se naše sonda zachytit i v místě, kde by nepasovala úplně dokonale (a), nebo třeba v místě, kde by sice pasovala skvěle, ale jenom na malém kousku (b).

Proto obvykle celý proces probíhá při 65 – 68 oC, pokud očekáváme naprostou komplementaritu, a při cca 50 – 55 oC, pokud si myslíme, že kousky DNA se přece jenom budou trochu lišit. Nachytávání sondy na membránu probíhá většinou přes noc, protože chceme mít naprostou jistotu, že se všechny molekuly s příslušným pořadím nukleotidů označily. Potom se ovšem musíme zbavit všech molekul nenavázané sondy. Proto membránu několikrát promýváme v řadě roztoků s přísně hlídaným složením a pH. Po dokonalém odmytí pak sondu zviditelníme – provedeme detekci. No, a když na citlivém filmu uvidíme černý flek (obrázek), tak tam námi hledaná DNA je. A když ho neuvidíme, tak tam buď není, nebo jsme někde v postupu udělali chybu – a můžeme začít znovu.

Sláva hybridizaci

Metodu hybridizace lze využít pro řadu experimentů. Uvedli jsme si příklad, kdy v dosud neprobádané DNA hledáme nějaký gen známý z jiného organizmu. Tak byla objevena spousta genů – jakmile badatelé najdou nějaký gen u myši, hned se podívají, jestli náhodou není také u člověka. Kromě toho podle míry komplementarity, tedy podle teploty, při níž spolu dva řetězce vytvoří dvouřetězec, lze poznat, jak moc jsou si dva kousky DNA z dvou různých organizmů podobné. A tak metodu hybridizace používají nejrůznější odborníci k určování příbuznosti až totožnosti druhů (evoluční biologové) nebo k určování příbuznosti až totožnosti jedinců (kromě ekologů a systematiků i forenzní genetici, to jest ti, co vám mohou přišít otcovství nebo taky vraždu).

Pomocí hybridizace můžeme najít jakýkoliv gen kdekoliv. Vzpomeňte si na příklad z minulého dílu – vyráběli jsme bakterii, která produkovala ve velkém lidský inzulin. Dříve, než se pro takovou bakterii postaví celá továrna, je třeba ověřit, zda v ní příslušný gen skutečně sídlí. To zjistíme tak, že v DNA bakterie specifickou sondou vyhledáme gen, který výrobu inzulinu zajišťuje. Bakterie samy takový kousek DNA nemají, takže pokud získáme na filmu černý flek, je jasné, že se přenos genu zdařil.

Metoda hybridizace nukleových kyselin však zdaleka neslouží jenom k vyhledávání určitého úseku DNA. Lze ji použít například jako metodu k určení relativní míry podobnosti dvou různých DNA. To se dělá tak, že se vezme DNA dvou různých organizmů a po denaturaci, tedy v jednořetězcové podobě, se smísí. Úseky DNA, které jsou komplementární, vytvoří hybridní dvouřetězce. Když pak změříme, kolik molekul zůstalo v jednořetězcové podobě (protože byly odlišné), získáme představu o relativní podobnosti našich dvou testovaných organizmů. Když to provedeme s obrovským množstvím dvojic a statisticky zhodnotíme, můžeme získat fylogenetický strom testovaných organizmů. Tak byl mimo jiné vytvořen v současnosti používaný systém ptáků (Vesmír 75, 692, 1996/12).

Hybridizovat lze nejen DNA, ale i RNA. Postup je v podstatě identický, jenom se kolem toho ještě více navyvádí. RNA je totiž (to už taky víte) poměrně nestabilní a stává se snadnou obětí enzymů. Proto s ní musíme pracovat velmi opatrně, abychom nepřátelům RNA nedali ani tu nejmenší šanci. Pokud tuto zásadu nedodržujeme, může být nepřítomnost signálu jenom důkazem naší špinavé práce, a nikoliv objevem zásadního charakteru.

To vše jsou jenom stručné ukázky možností využití techniky hybridizace nukleových kyselin. Stejně jako štěpení a spojování patří i hybridizace k základnímu arzenálu každé molekulárněbiologické laboratoře. Navíc na přelomu 80. a 90. let podnikla vítězné tažení do pracoven systematických zoologů a botaniků, kde však většinou zanechala jenom zmatek. Brzy ji totiž vytlačila jiná, mnohem snáze interpretovatelná a jednodušší metoda, o níž si povíme zas někdy příště. 1)

Poznámky

1) Autorka článku spolupracuje na grantu GA ČR 30251/1996. Redakce se omlouvá čtenářům i autorce za chybnou formulaci v souvislosti s grantem, uveřejněnou v minulém dílu.

Zase ta komplementarita


Opakování (Vesmír 77, 257, 1998/5)

V předchozím povídání jsme si řekli, že základní principy většiny metod molekulární biologie jsou velmi jednoduché, založené na fyzikálních a chemických vlastnostech nukleových kyselin. Opakovaně je třeba prohlašovat, že snad nejdůležitější vlastností je komplementarita doplňkovost molekul nukleových kyselin. Ty jsou vytvořeny řetězci nukleotidů, které se mohou propojit i vzájemně a vytvořit dvoušroubovici ovšem pouze tehdy, pokud si pořadí nukleotidů vzájemně odpovídá. Protože báze tvořící nukleotidy mohou v DNA vytvořit pouze dvě dvojice adenin s tyminem a guanin s cytozinem spojí se spolu dvě molekuly pouze tehdy, sejdou-li se příslušné dvojice vždy naproti sobě.

Spojení dvou řetězců přes báze jsou relativně slabá a fungují až od většího počtu nukleotidů. Ani síla vazby mezi dvojicemi není stejná G a C jsou spojeny třemi ručičkami, A a T pouze dvěma. Proto čím delší jsou vzájemně komplementární řetězce a čím více obsahují párů GC, tím lépe drží u sebe. Někdy dokonce tak dobře, že zůstanou spojeny i při vysoké teplotě, kdy je tepelný pohyb atomů a molekul velký a některé dvouřetězce se rozpadají na jednořetězce. Která ze dvou molekul

AATACGTAATTCACTAAGAT

TTATGCATTAAGTGATTGTA


GGCGCGTATGCAGCTAGCGGTACGTAGGC

CCGCGCATACGTCGATCGCCATGCATCCG


pak asi vydrží déle pohromadě, budeme-li neustále zvyšovat teplotu? No samozřejmě ta dole, neboť je delší a má více párů GC. Ale nic nemá věčné trvání zvýšíme-li teplotu na 96 oC, nevydrží pohromadě žádný dvouřetězec, i kdyby byl sebedelší a obsahoval jenom páry GC. Podobně jako na délce a obsahu párů GC, závisí míra soudržnosti i na homologii tedy na míře komplementarity. Pokud k sobě dva řetězce dobře pasují, vydrží i pořádné horko. Tak která z molekul vydrží vyšší teplotu?

GCGTAGCTGAGTAGCTA

CGCATCGACTCATCGAT


GCGTAGCTGAGTAGCTA

AGAATCTACTCCTCGCT


Vyhledávání DNA


  1. Označením známé molekuly DNA (např. pomocí radioaktivity) získáme sondu, která nám umožní zviditelnit komplementární úsek prohledávané DNA.

  2. Prohledávanou DNA izolujeme a v jednořetězcové podobě přeneseme a uchytíme na nosič (např. nylonovou membránu).

  3. K nosiči s prohledávanou DNA přidáme jednořetězcovou naznačenou sondu a necháme inkubovat při teplotě, která odpovídá míře očekávané shody mezi sondou a hledaným úsekem čím vyšší shoda, tím vyšší teplota, maximálně však používáme 68 oC.

  4. Po (většinou celonoční) inkubaci důkladně odmyjeme zbytky nenachytané sondy.

  5. Provedeme detekci přítomnosti sondy na membráně zůstala jenom tehdy (a jen v tom místě), pokud je v prohledávané DNA úsek k ní komplementární.

Podobně to lze provést i s RNA.

Ke stažení

OBORY A KLÍČOVÁ SLOVA: Genetika

O autorovi

Zuzana Storchová

Prof. Zuzana Storchová, Ph.D., (*1970) v roce 1989 obsadila 17. až 20. místo biologické olympiády. Vystudovala PřF UK Praha. Po doktorandském studiu u Vladimíra Vondrejse zamířila na dva roky do Curychu, kde se věnovala studiu postreplikativních oprav DNA. Od roku 2001 do roku 2007 pracovala na Dana Farber Cancer Institute/Harvard Medical School v Bostonu na projektu zaměřeném na studium polyploidie v kvasinkách. Od r. 2008 vede pracovní skupinu v Ústavu Maxe Plancka pro biochemii v Martinsriedu u Mnichova. Její skupina studuje vliv abnormálního počtu chromozomů na lidské buňky. V roce 2016 byla jmenována profesorkou molekulární genetiky na Technické univerzitě v Kaiserslauternu.

Doporučujeme

Přemýšlej, než začneš kreslit

Přemýšlej, než začneš kreslit

Ondřej Vrtiška  |  4. 12. 2017
Nástup počítačů, geografických informačních systémů a velkých dat proměnil tvorbu map k nepoznání. Přesto stále platí, že bez znalosti základů...
Tajemná „Boží země“ Punt

Tajemná „Boží země“ Punt uzamčeno

Břetislav Vachala  |  4. 12. 2017
Mnoho vzácného zboží starověkého Egypta pocházelo z tajemného Puntu, kam Egypťané pořádali časté obchodní výpravy. Odkud jejich expedice...
Hmyz jako dokonalý létací stroj

Hmyz jako dokonalý létací stroj

Rudolf Dvořák  |  4. 12. 2017
Hmyz patří k nejdokonalejším a nejstarším letcům naší planety. Jeho letové schopnosti se vyvíjely přes 300 milionů let a předčí dovednosti všech...

Předplatným pomůžete zajistit budoucnost Vesmíru

Tištěná i elektronická
verze časopisu
Digitální archiv
od roku 1994
Speciální nabídka
pro školy a studenty

 

Objednat předplatné