Genetika

Zoo v šálku čaje

Zoo v šálku čaje

Kateřina Bezányiová | 5. 9. 2022 | Vesmír 101, 514, 2022/9

Když noříte sáček se sušeným čajem do horké vody, připravujete si nápoj s koktejlem dědičné informace (DNA) více než 1200 živočichů. Ti všichni se...

Evropské potýkání s editací genů

Evropské potýkání s editací genů uzamčeno

Tomáš Moravec, Martin Janda | 5. 9. 2022 | Vesmír 101, 536, 2022/9

V roce 2012 byla objevena revolučně jednoduchá a zároveň precizní metoda editování genetické informace známá jako CRISPR (viz Vesmír 96, 576,...

Příbuzný je kamarád

Příbuzný je kamarád uzamčeno

Jaroslav Petr, Kateřina Bezányiová | 11. 7. 2022 | Vesmír 101, 464, 2022/7

Byl bych rád, kdyby mi někdo podrobněji objasnil následující tvrzení, které se vyskytuje ve Wikipedii, heslo Mravencovití, kapitola Pohlaví...

Zámek a klíč

Zámek a klíč uzamčeno

Eduard Kejnovský | 11. 7. 2022 | Vesmír 101, 500, 2022/7

Protiklady se prý přitahují. Je to snad proto, že pokud se doplňují, může jejich spojení přinést novou kvalitu, nastartovat nějaký proces? Všude...

Šifra opata Gregora

Šifra opata Gregora

Ondřej Vrtiška | 30. 5. 2022 | Vesmír 101, 343, 2022/6

„GCCTATTCCAGGTATGGGTTTGCC…“ Kdybyste předchozí řádek ukázali Gregoru Johannu Mendelovi nebo kterémukoli z jeho současníků, zíral by na vás dost...

Slavný všude, jen ne u nás

Slavný všude, jen ne u nás

Marek Vácha | 30. 5. 2022 | Vesmír 101, 358, 2022/6

„Nikdy si nepsal deník a jeho dopisy vrhají na jeho vnitřní život jen málo světla. Jakožto kněz musel být obzvláště obezřelý při vyjádření svých...

G. J. Mendel pohledem antropologie a genetiky

G. J. Mendel pohledem antropologie a genetiky uzamčeno

Eva Drozdová, Michael Doubek, Šárka Pospíšilová | 30. 5. 2022 | Vesmír 101, 364, 2022/6

Na výzkumu ostatků Gregora Johanna Mendela (1822–1884), iniciovaném u příležitosti blížícího se dvoustého výročí narození tohoto významného...

Umožní editace genomů nasytit lidstvo?

Umožní editace genomů nasytit lidstvo? uzamčeno

Od objevu zákonů dědičnosti augustiniánským mnichem Gregorem Johannem Mendelem roku 1866 učinila genetika velký pokrok. Pochopili jsme fungování...

Ovlivníme myšlenkami naši DNA?

Ovlivníme myšlenkami naši DNA? uzamčeno

Eduard Kejnovský | 30. 5. 2022 | Vesmír 101, 372, 2022/6

Když Gregor Mendel objevil a popsal zákony dědičnosti, nevěděl nic o nositelce dědičné informace, molekule DNA. S dnešními znalostmi genetiky je...

Přichází GATTACA?

Jaroslav Petr | 2. 5. 2022 | Vesmír 101, 286, 2022/5

Genetické testování lidských embryí pokročilo od detekce jednotlivých vloh k hodnocení celého genomu.

Předplatným pomůžete zajistit budoucnost Vesmíru

Tištěná i elektronická
verze časopisu
Digitální archiv
od roku 1994
Speciální nabídka
pro školy a studenty

 

Objednat předplatné