i

Aktuální číslo:

2022/6

Téma měsíce:

200 let G. J. Mendela

Šifra opata Gregora

 |  30. 5. 2022
 |  Vesmír 101, 343, 2022/6

„GCCTATTCCAGGTATGGGTTTGCC…“

Kdybyste předchozí řádek ukázali Gregoru Johannu Mendelovi nebo kterémukoli z jeho současníků, zíral by na vás dost nechápavě. Čtyři nepravidelně se střídající písmena, hm, to bude nějaký kód. Šifra. Ale jaký je k ní klíč?

Snaha o její prolomení by s tehdejšími znalostmi neměla naději na úspěch. Čtyři písmena tvoří po sobě jdoucí trojice, triplety. Celkem 43, tedy 64 kombinací, z nichž každá kóduje buď některou z dvaceti aminokyselin (většinu tedy kóduje více tripletů), nebo dělá „tečku za větou“. Přepis navíc neprobíhá přímo, ale přes prostředníka v podobě molekuly RNA. Aminokyseliny se pak řetězí do proteinů, plnících v těle nejrůznější funkce od stavebních prvků po katalýzu biochemických reakcí. Navíc některé sekvence se do aminokyselin nepřepisují a jejich cesta končí na úrovni molekul RNA, plnících opět nejrůznější, povětšinou regulační a signalizační funkce. A další části čtyřpísmenného řetězce se nepřepisují nikam a rovněž slouží „pouze“ k regulaci přepisu zbývajících částí „textu“, případně se jedná o harampádí nahromaděné v „knize života“ za miliardy let evoluce. Ani o něm ale není moudré tvrdit, že je k ničemu – v tomto směru jsme se v minulosti příliš často mýlili.

Vyznat se v takovém zmatku je pro člověka obtížné – i pro dnešní molekulární biology vybavené znalostmi nastřádanými v posledním století, špičkovými laboratorními přístroji a výkonnými počítači. Pro badatele z 19. století, kteří neměli ponětí o struktuře DNA ani o její biologické funkci, to bylo zhola nemožné. Gregor Johann Mendel přesto dokázal odhalit fundamentální zákony, jimiž se dědičná informace zapsaná do neviditelného makromolekulárního řetězce řídí při předávání do příští generace. Jsem si jist, že pohled na obálku tohoto vydání Vesmíru by ho fascinoval, i kdyby nevěděl, že sekvence DNA, z níž je poskládána, je jeho vlastní (viz s. 366).

„Většina významných průkopníků nových myšlenek upadne postupně v zapomnění, a to často už vinou svých současníků, kteří je nedovedli docenit, natož předvídat význam jejich myšlenek do budoucna,“ píše na s. 390 Petr Šíma. Svým článkem připomíná Vojtěcha Vincence Zardu, lékaře, který na sklonku 18. století založil první záchrannou stanici v českých zemích. Citát se ale blízce dotýká i příběhu starobrněnského opata. Docenění svého průkopnického díla se nedožil, genetika si na svůj rozvoj musela počkat až na počátek 20. století. Mendel své zásadní poznatky zformuloval v přednáškách z roku 1865 a o rok později je publikoval (viz s. 358). Přesto o něm Vesmír v roce 1880 psal pouze jako o „muži ve včelařství dobře obeznalém“, a dokonce ho ani nezmínil jménem, protože v popisovaném příběhu introdukovaných amerických včel hrál jen okrajovou úlohu. Ani autor článku, ani nikdo jiný v té době neměl tušení, jak důležité objevy Mendel učinil (viz Vertikálu, Vesmír 99, 59, 2020/1). Jeho dílo se naštěstí dočkalo uznání alespoň posmrtně a dvousté výročí Mendelova narození si letos připomíná celý svět. Genetika od svého znovuobjevení urazila dalekou cestu, k základním Mendelovým zákonům přibylo mnoho složitějších pravidel (a nepravidelností). Některým z nich se věnují články na stranách 369 a 372. A spletitý příběh čtyřpísmenného kódu tím jistě zdaleka nekončí… 

Ke stažení

OBORY A KLÍČOVÁ SLOVA: Historie vědy, Genetika
RUBRIKA: Úvodník

O autorovi

Ondřej Vrtiška

Mgr. Ondřej Vrtiška (*1976) je původním vzděláním biolog se specializací na hydrobiologii (PřF UK), utekl z oborů žurnalistika a kulturní antropologie (obojí FSV UK). Od r. 2001 pracuje jako vědecký novinář, na téma „věda v médiích“ přednáší pro vědce i pro laickou veřejnost. Z úžasu nevycházející pozorovatel memetické vichřice. Občas napíná plachty, občas staví větrolam.
Vrtiška Ondřej

Doporučujeme

Slavný všude, jen ne u nás

Slavný všude, jen ne u nás

Marek Vácha  |  30. 5. 2022
„Nikdy si nepsal deník a jeho dopisy vrhají na jeho vnitřní život jen málo světla. Jakožto kněz musel být obzvláště obezřelý při vyjádření svých...
Nejstarší Evropanka

Nejstarší Evropanka uzamčenovideo

Ve čtvrtek 14. září 1950 se v lomu pod návrším Zlatý kůň u Berouna chystají k odstřelu vápence. Je určen pro výrobu cementu. Zahřmí výbuch...
Prolévat luteránskou krev

Prolévat luteránskou krev uzamčeno

Petr Vorel  |  30. 5. 2022
Když se řekne „křížová výprava“, vybaví si čtenář nejspíš tažení středověkých rytířů k Božímu hrobu do Palestiny. Anebo zbabělé křižáky, prchající...

Předplatným pomůžete zajistit budoucnost Vesmíru

Tištěná i elektronická
verze časopisu
Digitální archiv
od roku 1994
Speciální nabídka
pro školy a studenty

 

Objednat předplatné